Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

نویسندگان

  • T A Casey
  • W T Ruyechan
  • M N Flora
  • W Reinhold
  • S E Straus
  • J Hay
چکیده

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Enzymatic Digestion Pattern of Varicella Zoster Virus ORF38 and ORF54 in Chickenpox Patients Using RFLP Technique

Background: Varicella zoster virus (VZV) causes chickenpox in children and zoster (zona) in the elderly. Using RFLP-PCR method for detection of VZV specific SNPs ORF38, 54 and 62 could  distinguish the profile of VZV isolates. The aim of this study was to investigate enzymatic digestion pattern of VZV ORF38 and ORF54 in chickenpox patients using RFLP technique. <b...

متن کامل

Varicella Zoster Virus (VZV) Origin-Dependent Plasmid Replication in the Presence of the Four Overlapping Cosmids Comprising the Complete Genome of VZV

The Varicella-Zoster Virus (VZV) genome contains both cis-acting and trans-acting elements, which are important in viral DNA replication. The cis-acting elements consist of two copies of oriS, and the trans-acting elements are those genes whose products are required for virus DNA replication. It has been shown that each of the seven genes required for ori-dependent DNA synthesis of Herpes Simpl...

متن کامل

Molecular cloning and physical mapping of varicella-zoster virus DNA.

Varicella-zoster virus (VZV) DNA was cleaved with restriction endonuclease EcoRI, and most of the resulting fragments were successfully cloned in the phage vector lambda gtWES . lambda B. Double digestions of cloned fragments with EcoRI and BamHI and hybridizations to blot-transferred BamHI digests of VZV DNA were used to construct a physical map of the genome. The molecular termini of the DNA ...

متن کامل

Varicella Exposure in Neonatal Intensive Care Unit in a Low Resource Country: Successful Prophylaxis with Intravenous Immunoglobulins

Background: Varicella-zoster infection is a serious and potentially fatal disease, especially among newborns.Several studies have described postnatal varicella zoster exposure among neonates and reported on the efficacy of varicella-zoster immunoglobulins (VZIG) used as post-exposure prophylaxis. Unfortunately, VZIG is not available in Jordan. A limited number of studies have investigated the e...

متن کامل

Seroprevalence of Varicella-Zoster Virus in Children from Shiraz-Iran

Background: Varicella–zoster virus (VZV) causes herpes zoster and varicella (Chicken-pox), usually a mild disease which is diagnosed clinically with few complications. However, in neonates and healthy adults it can have a severe presentation. Herpes zoster results from VZV reactivation later in life. Objective: To determine the seroprevalence of VZV in elementary school children aged 6-10 years...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

عنوان ژورنال:
  • Journal of virology

دوره 54 2  شماره 

صفحات  -

تاریخ انتشار 1985